Announcement
Starting on July 4, 2018 the Indonesian Publication Index (IPI) has been acquired by the Ministry of Research Technology and Higher Education (RISTEKDIKTI) called GARUDA Garba Rujukan Digital (http://garuda.ristekdikti.go.id)
For further information email to portalgaruda@gmail.com

Thank you
Logo IPI  
Journal > JURNAL ILMU-ILMU PETERNAKAN > Development of Genetic Marker for Selection Program of Growth Traits in Local Cattle

 

JURNAL ILMU-ILMU PETERNAKAN
Vol 18, No 3 (2008)
Development of Genetic Marker for Selection Program of Growth Traits in Local Cattle
Suyadi, Suyadi ( Fakultas Peternakan Universitas Brawijaya)
Maylinda, S. ( Fakultas Peternakan Universitas Brawijaya)
Nugroho, H. ( Fakultas Peternakan Universitas Brawijaya)
Kuswati, Kuswati ( Fakultas Peternakan Universitas Brawijaya)
Article Info   ABSTRACT
Published date:
17 Oct 2010
 
The aim of the research was to examine the effect of Growth Hormon/GH genotype on PO cattle growth. Observation was done on cattle calves up to 1 year old. GH polymorphism was analysed using PCR-RFLP, amplification of GH fragment a fragment using primer F = 5’– CCCACGGGCAAGAATGAGGC - 3’ and R = 5’ – TGAGGAACTGCAGGGGCCCA – 3’. The PCR product was digested with restriction enzyme Msp1. The RFLP product was examined with electrophoresis using 2 % agarose gel.Result showed that the GH genotypes affected growth of PO calves only on weaning weight (P < 0,05), on birth weight and weight on 1 year old were not significant. AB genotype related with the highest weanng weight, AA genotype related with medium weaning weight. It was suggested that AB and AA genotypes can be used as marker in bull selection (JIIPB 2008 Vol 18 No 3: 165-173).Keywords: Genotype, Growth Hormone gene, birth weight, weaning weight, yearling body weight,, RFLP.
Copyrights © 2010