Announcement
Starting on July 4, 2018 the Indonesian Publication Index (IPI) has been acquired by the Ministry of Research Technology and Higher Education (RISTEKDIKTI) called GARUDA Garba Rujukan Digital (http://garuda.ristekdikti.go.id)
For further information email to portalgaruda@gmail.com

Thank you
Logo IPI  
Journal > Jurnal Veteriner > THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

 

Full Text PDF (737 kb)
Jurnal Veteriner
Vol 9, No 1 (2008)
THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER
Article Info   ABSTRACT
Published date:
01 Mar 2008
 
A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR) technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward) and 5’- CAAGATAACCATGTACGGTGC-3’ (backward). A single band of 300 bp which was specific for canine distemper virus CDV) was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.
Copyrights © 2008