Announcement
Starting on July 4, 2018 the Indonesian Publication Index (IPI) has been acquired by the Ministry of Research Technology and Higher Education (RISTEKDIKTI) called GARUDA Garba Rujukan Digital (http://garuda.ristekdikti.go.id)
For further information email to portalgaruda@gmail.com

Thank you
Logo IPI  
Journal > Jurnal Hortikultura > Deteksi dan Identifikasi Chrysanthemum Stunt Viroid pada Tanaman Krisan Menggunakan Teknik Reverse Transcriptase Polymerase Chain Reaction (Detection and Identification of Chrysanthemum Stunt Viroid on Chrysanthemum Using Reverse Transcriptase Polymerase

 

Full Text PDF (452 kb)
Jurnal Hortikultura
Vol 23, No 1 (2013): Maret 2013
Deteksi dan Identifikasi Chrysanthemum Stunt Viroid pada Tanaman Krisan Menggunakan Teknik Reverse Transcriptase Polymerase Chain Reaction (Detection and Identification of Chrysanthemum Stunt Viroid on Chrysanthemum Using Reverse Transcriptase Polymerase
Diningsih, Erniawati ( Balai Penelitian Tanaman Hias)
Suastika, I gede ( Institut pertanian Bogor)
Sulyo, Yoyoh ( Balai Penelitian Tanaman Hias)
Winarto, Budi ( Balai Penelitian Tanaman Hias)
Article Info   ABSTRACT
Published date:
17 Dec 2015
 
Chrysanthemum stunt viroid (CSVd) merupakan salah satu viroid yang menginfeksi tanaman krisan di Indonesia. Tujuan penelitian ialah untuk mengembangkan metode deteksi CSVd secara molekuler dan mengkarakterisasi CSVd isolat Indonesia. Penelitian dilaksanakan di Laboratorium Virologi Tumbuhan, Departemen Proteksi Tanaman, Institut Pertanian Bogor, dan Rumah Kaca serta Laboratorium Virologi, Balai Penelitian Tanaman Hias, Segunung, Cianjur, Jawa Barat, dari Bulan Mei 2007 sampai dengan Juni 2008. RNA total diekstraksi dari daun tanaman krisan yang dihasilkan di rumah kaca menggunakan rneasy plant mini kits. Genom CSVd diamplifikasi dengan pasangan primer 5’-CAACTGAAGCTTCAACGCCTT-3’ dan 5’-AGGATTACTCCT- GTCTCGCA-3’. Suatu fragmen dengan ukuran 250 bp mengindikasikan bahwa c-DNA CSVd berhasil diamplifikasi dari tanaman krisan sakit menggunakan teknik RT-PCR. Urutan cDNA dari salah satu CSVd isolat Indonesia berhasil ditemukan dengan urutan sebagai berikut: cttaggattactcctgtctcgcaggagtggggtcctaagcctcattcga ttgcgcg aatctcgtcgtgcacttcctccagggatttccccgggggataccctgtaag- gaacttcttcgcctcatttcttttaagcagcagggttcaggagtgcaccacaggaaccacaagtaagtcccgagggaacaaaactaaggttccacgggcttactccctagcccaggtag- gctaaagaagattggaa. Urutan basa-basa tersebut memiliki tingkat kesamaan yang tinggi dengan sekuen nukleotida isolat CSVd dari Jepang, Korea, India, dan Amerika. 
Copyrights © 2015